View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0830_low_128 (Length: 249)
Name: NF0830_low_128
Description: NF0830
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0830_low_128 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 166; Significance: 6e-89; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 166; E-Value: 6e-89
Query Start/End: Original strand, 7 - 226
Target Start/End: Complemental strand, 38287595 - 38287378
Alignment:
| Q |
7 |
tagattattcttgcctgatgaccgaacctctttttcctgagaaaccagagggttaacacnnnnnnntattgcattcttaatttacgagtatattttctcc |
106 |
Q |
| |
|
|||||||| |||| ||||||||||||||||||||| ||||||||||||||||||||||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
38287595 |
tagattatccttgtctgatgaccgaacctcttttttctgagaaaccagagggttaacacaaaaaa-tattgcattcttaatttacgagtatattttctcc |
38287497 |
T |
 |
| Q |
107 |
tgacatgaatgtgtgtgtatttgtgtgtctatatatgtattaaggaaaatggaaaagggtagagtagtaccactcctatacaatttggaaccagtacaaa |
206 |
Q |
| |
|
|| ||||||||||||| |||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38287496 |
tg-catgaatgtgtgtttatttgtgtgtctatatacgtattaaggaaaatggaaaagggtagagtagtaccactcctatacaatttggaaccagtacaaa |
38287398 |
T |
 |
| Q |
207 |
gtgatatcatacgcacagac |
226 |
Q |
| |
|
|||||||||||||||||||| |
|
|
| T |
38287397 |
gtgatatcatacgcacagac |
38287378 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University