View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0830_low_129 (Length: 249)
Name: NF0830_low_129
Description: NF0830
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0830_low_129 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 103; Significance: 2e-51; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 103; E-Value: 2e-51
Query Start/End: Original strand, 136 - 242
Target Start/End: Original strand, 52807994 - 52808100
Alignment:
| Q |
136 |
ataataataatgtgagaaggatgtttgattggtgttagagcataagacaaacaaatacttgcatgattggtttatggatgaaacctggcaattatggtat |
235 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
52807994 |
ataataataatgtgagaaggatgtttgattggtgttagagcataagacaaacaaatacttgcatgattggtctatggatgaaacctggcaattatggtat |
52808093 |
T |
|
| Q |
236 |
tttgttg |
242 |
Q |
| |
|
||||||| |
|
|
| T |
52808094 |
tttgttg |
52808100 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 1406 times since January 2019
Visitors: 6140