View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0830_low_132 (Length: 242)
Name: NF0830_low_132
Description: NF0830
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0830_low_132 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 171; Significance: 6e-92; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 171; E-Value: 6e-92
Query Start/End: Original strand, 19 - 213
Target Start/End: Complemental strand, 55078899 - 55078705
Alignment:
Q |
19 |
catttaaactctgatcatcaatgatggccaccagaggtggcaatcgaaggcttggcagtatcaacagacttgggagtaggaaaaataattaccgccaata |
118 |
Q |
|
|
||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||| |||||||||| ||||||||||||||||| |
|
|
T |
55078899 |
catttaaactctgatcatcaatgatggccaccagaggtggcaatcgatggcttggcagtatcaacagactttggagtaggaagaataattaccgccaata |
55078800 |
T |
 |
Q |
119 |
tagcgctgatgactgcggccacaacaccgaccacaaacgccggcaagttgccaccaccaaacaaagcatcccacggtccacttaatgacgatact |
213 |
Q |
|
|
|||||||||||||||||||||| || |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
55078799 |
cagcgctgatgactgcggccacagcatcgaccacaaacgccggcaagttgccaccaccaaacaaagcatcccacggtccacttaatgacgatact |
55078705 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6 (Bit Score: 42; Significance: 0.000000000000006; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 42; E-Value: 0.000000000000006
Query Start/End: Original strand, 112 - 205
Target Start/End: Original strand, 15123040 - 15123133
Alignment:
Q |
112 |
gccaatatagcgctgatgactgcggccacaacaccgaccacaaacgccggcaagttgccaccaccaaacaaagcatcccacggtccacttaatg |
205 |
Q |
|
|
|||||| |||| ||||||||||| ||||| |||| ||||| ||||| || |||||||||||||||||||||| ||||| |||||||||||| |
|
|
T |
15123040 |
gccaatgtagcactgatgactgccgccaccgcaccaaccacgaacgcaggtaagttgccaccaccaaacaaagagtcccattgtccacttaatg |
15123133 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University