View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0830_low_135 (Length: 235)
Name: NF0830_low_135
Description: NF0830
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0830_low_135 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 134; Significance: 7e-70; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 134; E-Value: 7e-70
Query Start/End: Original strand, 1 - 138
Target Start/End: Complemental strand, 3908751 - 3908614
Alignment:
| Q |
1 |
agtttttagccatagcagccatggtcaactgatcggttgattgtggcagtgttggctgagacagagaagaattacttgatggtgttgaggatgatggagt |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3908751 |
agtttttagccatagcagccatggtcaactgatcggttgattgtggcagtgttggctgagacagagaagaattacttgatggtgttgaggatgatggagt |
3908652 |
T |
 |
| Q |
101 |
tttggctttctttcccttacgacaaccaccaccaatag |
138 |
Q |
| |
|
||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
3908651 |
tttggatttctttcccttacgacaaccaccaccaatag |
3908614 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University