View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0830_low_143 (Length: 212)
Name: NF0830_low_143
Description: NF0830
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0830_low_143 |
 |  |
|
| [»] scaffold0069 (1 HSPs) |
 |  |  |
|
Alignment Details
Target: scaffold0069 (Bit Score: 111; Significance: 3e-56; HSPs: 1)
Name: scaffold0069
Description:
Target: scaffold0069; HSP #1
Raw Score: 111; E-Value: 3e-56
Query Start/End: Original strand, 24 - 146
Target Start/End: Complemental strand, 15898 - 15776
Alignment:
| Q |
24 |
attaataaccattagatattaattaacggttgagattaagttgctcattaaaaaccatagtgtactagatcctttttgcatcaaagaactttcatcttcc |
123 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||| ||||||||||| ||||||||||||||||||||| |
|
|
| T |
15898 |
attaataaccattagatattaattaacggttgagattaagttgctcattaaaaactatagtgtactggatcctttttgtatcaaagaactttcatcttcc |
15799 |
T |
 |
| Q |
124 |
ttgctcacttttttcttccgtct |
146 |
Q |
| |
|
||||||||||||||||||||||| |
|
|
| T |
15798 |
ttgctcacttttttcttccgtct |
15776 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 74; Significance: 4e-34; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 74; E-Value: 4e-34
Query Start/End: Original strand, 24 - 124
Target Start/End: Complemental strand, 13913460 - 13913359
Alignment:
| Q |
24 |
attaataaccattagatattaattaacggttgagattaagttgctcattaaaaaccatagtgtactagatcct-ttttgcatcaaagaactttcatcttc |
122 |
Q |
| |
|
||||||||||||| ||||||||||||||||||||||||||||||||||||||||| |||||| || |||||| |||||||||||||||||||||||||| |
|
|
| T |
13913460 |
attaataaccattggatattaattaacggttgagattaagttgctcattaaaaactatagtgcaccggatcctcttttgcatcaaagaactttcatcttc |
13913361 |
T |
 |
| Q |
123 |
ct |
124 |
Q |
| |
|
|| |
|
|
| T |
13913360 |
ct |
13913359 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 48; Significance: 1e-18; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 48; E-Value: 1e-18
Query Start/End: Original strand, 151 - 198
Target Start/End: Complemental strand, 36170866 - 36170819
Alignment:
| Q |
151 |
tcctccacaatttcctcttctttcttcatctttagttttgctttcttt |
198 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36170866 |
tcctccacaatttcctcttctttcttcatctttagttttgctttcttt |
36170819 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 43; E-Value: 0.000000000000001
Query Start/End: Original strand, 25 - 87
Target Start/End: Original strand, 15044670 - 15044732
Alignment:
| Q |
25 |
ttaataaccattagatattaattaacggttgagattaagttgctcattaaaaaccatagtgta |
87 |
Q |
| |
|
||||||||| |||||| |||||||||| ||||||||||||||||||||||| || |||||||| |
|
|
| T |
15044670 |
ttaataaccgttagatgttaattaacgattgagattaagttgctcattaaacactatagtgta |
15044732 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 47; Significance: 5e-18; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 47; E-Value: 5e-18
Query Start/End: Original strand, 24 - 124
Target Start/End: Complemental strand, 19069250 - 19069146
Alignment:
| Q |
24 |
attaataaccattagatattaattaacggttgagattaagttgctcattaaaaaccatagtgtactaga---tcctttttgcatca-aagaactttcatc |
119 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||||| ||| | ||||||||||| | |||||||| || |||||||||||||| ||| ||||||||| |
|
|
| T |
19069250 |
attagtaaccattagatattaattaacggttgagatcaaggttgtcattaaaaactacagtgtactggatcttcctttttgcatcagaagcactttcatc |
19069151 |
T |
 |
| Q |
120 |
ttcct |
124 |
Q |
| |
|
||||| |
|
|
| T |
19069150 |
ttcct |
19069146 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 24 - 96
Target Start/End: Original strand, 19068514 - 19068586
Alignment:
| Q |
24 |
attaataaccattagatattaattaacggttgagattaagttgctcattaaaaaccatagtgtactagatcct |
96 |
Q |
| |
|
|||| |||||||||||||||| |||||||||||||| ||| || ||||||||||| | |||||||| |||||| |
|
|
| T |
19068514 |
attagtaaccattagatattagttaacggttgagatcaaggtggtcattaaaaactacagtgtactggatcct |
19068586 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University