View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF0830_low_148 (Length: 209)

Name: NF0830_low_148
Description: NF0830
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF0830_low_148
NF0830_low_148
[»] chr2 (1 HSPs)
chr2 (22-85)||(3340707-3340770)


Alignment Details
Target: chr2 (Bit Score: 60; Significance: 9e-26; HSPs: 1)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 60; E-Value: 9e-26
Query Start/End: Original strand, 22 - 85
Target Start/End: Complemental strand, 3340770 - 3340707
Alignment:
22 gattattctgattgtgatttcaatacctccatagctctctcctcctatgtacaatgcccttgtt 85  Q
    |||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||    
3340770 gattattctgatggtgatttcaatacctccatagctctctcctcctatgtacaatgcccttgtt 3340707  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University