View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0830_low_148 (Length: 209)
Name: NF0830_low_148
Description: NF0830
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0830_low_148 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 60; Significance: 9e-26; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 60; E-Value: 9e-26
Query Start/End: Original strand, 22 - 85
Target Start/End: Complemental strand, 3340770 - 3340707
Alignment:
Q |
22 |
gattattctgattgtgatttcaatacctccatagctctctcctcctatgtacaatgcccttgtt |
85 |
Q |
|
|
|||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
3340770 |
gattattctgatggtgatttcaatacctccatagctctctcctcctatgtacaatgcccttgtt |
3340707 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University