View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF0830_low_153 (Length: 204)

Name: NF0830_low_153
Description: NF0830
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF0830_low_153
NF0830_low_153
[»] chr6 (1 HSPs)
chr6 (1-102)||(28540018-28540119)


Alignment Details
Target: chr6 (Bit Score: 94; Significance: 4e-46; HSPs: 1)
Name: chr6
Description:

Target: chr6; HSP #1
Raw Score: 94; E-Value: 4e-46
Query Start/End: Original strand, 1 - 102
Target Start/End: Original strand, 28540018 - 28540119
Alignment:
1 atggaaaacaccagcaacgaatctacgttgtcaagtaactcgatcagaagttatagaaaacggattatcaccgcctctgagtccatgtagatcaccggta 100  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||| |||||||||||||||||||||||    
28540018 atggaaaacaccagcaacgaatctacgttgtcaagtaactcgatcagaagttatagaaaacggattatcaccacctatgagtccatgtagatcaccggta 28540117  T
101 ct 102  Q
    ||    
28540118 ct 28540119  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University