View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0830_low_154 (Length: 204)
Name: NF0830_low_154
Description: NF0830
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0830_low_154 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 94; Significance: 4e-46; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 94; E-Value: 4e-46
Query Start/End: Original strand, 1 - 102
Target Start/End: Original strand, 28540018 - 28540119
Alignment:
Q |
1 |
atggaaaacaccagcaacgaatctacgttgtcaagtaactcgatcagaagttatagaaaacggattatcaccgcctctgagtccatgtagatcaccggta |
100 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||| ||||||||||||||||||||||| |
|
|
T |
28540018 |
atggaaaacaccagcaacgaatctacgttgtcaagtaactcgatcagaagttatagaaaacggattatcaccacctatgagtccatgtagatcaccggta |
28540117 |
T |
 |
Q |
101 |
ct |
102 |
Q |
|
|
|| |
|
|
T |
28540118 |
ct |
28540119 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 966 times since January 2019
Visitors: 6135