View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0830_low_26 (Length: 571)
Name: NF0830_low_26
Description: NF0830
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0830_low_26 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 274; Significance: 1e-153; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 274; E-Value: 1e-153
Query Start/End: Original strand, 1 - 303
Target Start/End: Complemental strand, 53148119 - 53147821
Alignment:
| Q |
1 |
tttctcatcactcaattgagattaatgaatgtttcttgattctcacaatgtcatttgcttaattaacttcgttcaatttcgattcatatctagatccttt |
100 |
Q |
| |
|
||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| || |
|
|
| T |
53148119 |
tttctcatcactcaattgagattaatg----tttcttgattctcacaatgtcatttgcttaattaacttcgttcaatttcgattcatatctagatccgtt |
53148024 |
T |
 |
| Q |
101 |
gaatttcattgttcatgtttatctctgtttctatgtcttgattatcgacgattgaaatcgtgacgattcagaggttataaaatcctgcagtataattgaa |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
53148023 |
gaatttcattgttcatgtttatctctgtttctatgtcttgattatcgatgattgaaatcgtgacgattcagaggttataaaatcctgcagtataattgaa |
53147924 |
T |
 |
| Q |
201 |
gtaagttgaagaatgtgcactctgaaaattctagaggatccaattcaatttttggaagatctatgatttcgatgcccacacttaacttaaaatgcattaa |
300 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
53147923 |
gtaagttgaagaatgtgcactctgaaaattctagaggatccaattcaatttttggaagatctatgatatcgatgcccacacttaacttaaaatgcattaa |
53147824 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 155; E-Value: 5e-82
Query Start/End: Original strand, 314 - 476
Target Start/End: Complemental strand, 53147787 - 53147626
Alignment:
| Q |
314 |
tgatataaaacgaagcttccgtgacttttttgtgtaatgataaaatattttagggattgatatgatacggaaataaataaaaatcagtgatacgtcaaca |
413 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
53147787 |
tgatataaaacgaagcttccgtgacttttttgtgtaatgataaaatattttagggattgatatgatacggaaataaataaaa-tcagtgatacgtcaaca |
53147689 |
T |
 |
| Q |
414 |
ttcctgactttctggatccctcatactttttgctatctgtagatcttgggaaacatgatgatg |
476 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
53147688 |
ttcctgactttctggatccctcatactttttgctatctgtagatcttgggaaacatgatgatg |
53147626 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University