View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0830_low_43 (Length: 432)
Name: NF0830_low_43
Description: NF0830
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0830_low_43 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 259; Significance: 1e-144; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 259; E-Value: 1e-144
Query Start/End: Original strand, 161 - 419
Target Start/End: Original strand, 16801440 - 16801698
Alignment:
| Q |
161 |
gtaacttgaaaagattatatccttgctattgttggtagagtgccgttaatcaagactgtagttcaaaatatgattcttcattatatttccatctactctt |
260 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
16801440 |
gtaacttgaaaagattatatccttgctattgttggtagagtgccgttaatcaagactgtagttcaaaatatgattcttcattatatttccatctactctt |
16801539 |
T |
 |
| Q |
261 |
ggccagtaagcttacttaaagatatggaaatgtggttgagaaattcatctggattagtcatagaaatagggcttcgaattagagatttgtcaagtatcaa |
360 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
16801540 |
ggccagtaagcttacttaaagatatggaaatgtggttgagaaattcatctggattagtcatagaaatagggcttcgaattagagatttgtcaagtatcaa |
16801639 |
T |
 |
| Q |
361 |
tgaagtagcaaatattataaagctttgtttgggatatcattcaatcagatttgcaacag |
419 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
16801640 |
tgaagtagcaaatattataaagctttgtttgggatatcattcaatcagatttgcaacag |
16801698 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University