View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0830_low_67 (Length: 372)
Name: NF0830_low_67
Description: NF0830
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0830_low_67 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 288; Significance: 1e-161; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 288; E-Value: 1e-161
Query Start/End: Original strand, 56 - 359
Target Start/End: Original strand, 42238773 - 42239076
Alignment:
| Q |
56 |
aaaatctaccacattaagacaggatgaaagctaggaaaccaaaggttgaaacaaacaaccagaagaaaataaataattatataagttattcgttttcttc |
155 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||| ||||||||||| |
|
|
| T |
42238773 |
aaaatctaccacattaagacaggatgaaagctaggaaaccaaaggttgaaacaaacaaccagaagaaaataaatagttatataagttactcgttttcttc |
42238872 |
T |
|
| Q |
156 |
gggtatagaatccaatattggcttccgatcacatgtcaaactaacaccatctgttttaacaattgataatagttcctgtaatgacatttctttggtcact |
255 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42238873 |
gggtatagaatccaatattggcttccgatcacatgtcaaactaacaccatctgttttaacaactgataatagttcctgtaatgacatttctttggtcact |
42238972 |
T |
|
| Q |
256 |
aactgttgaagctgctgtttcgttattaaaactttgattctctttgtctttgtcccaccaccaccttgttcttctgcctctttgttatgtggaatcaagt |
355 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42238973 |
aactgttgaagctgctgtttcgttattaaaactttgatcctctttgtctttgtcccaccaccaccttgttcttctgcctctttgttatgtggaatcaagt |
42239072 |
T |
|
| Q |
356 |
agta |
359 |
Q |
| |
|
|||| |
|
|
| T |
42239073 |
agta |
42239076 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 879 times since January 2019
Visitors: 6134