View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0830_low_69 (Length: 369)
Name: NF0830_low_69
Description: NF0830
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0830_low_69 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 163; Significance: 6e-87; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 163; E-Value: 6e-87
Query Start/End: Original strand, 30 - 227
Target Start/End: Complemental strand, 52070862 - 52070672
Alignment:
| Q |
30 |
gatcaaatgttaacaatccaccaataattggctaatccatacttaaaaagttgacatgtatattattattaacccataattaagacatgcaccactgata |
129 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
52070862 |
gatcaaatgttaacaatccaccaataattggctaatccatacttaaaaagttgacatgtatatta------acccataattaagacatgcaccactgata |
52070769 |
T |
|
| Q |
130 |
taaaataagtcatcaacaaaatttctccaatatgaaaaccaaggcattctatgtggggtttgtgtgatagacattttttactagcatacatacccatt |
227 |
Q |
| |
|
||||| ||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
52070768 |
taaaa-aagtcatcaacaaaatttctccaatatgaaaaccagggcattctatgtggggtttgtgtgatagacattttttactagcatacatacccatt |
52070672 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 242 - 280
Target Start/End: Complemental strand, 52070672 - 52070634
Alignment:
| Q |
242 |
ttcaattaaaacctcaatcgtgcaggaagagtcgtacac |
280 |
Q |
| |
|
||||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
52070672 |
ttcaattaaaacctcaatcatgcaggaagagtcgtacac |
52070634 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 1616 times since January 2019
Visitors: 6145