View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0830_low_71 (Length: 362)
Name: NF0830_low_71
Description: NF0830
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0830_low_71 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 253; Significance: 1e-140; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 253; E-Value: 1e-140
Query Start/End: Original strand, 57 - 334
Target Start/End: Original strand, 35171896 - 35172173
Alignment:
Q |
57 |
gataatacttgaagtgctttcggtaagagctgcaagtcttgtatgannnnnnngatcacctacttataacgaaatcaacagtgtagtgaacatatatgtg |
156 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||| ||||||||||||||||||||| |
|
|
T |
35171896 |
gataatacttgaagtgctttcggtaagagctgcaagtcttgtatgatttttttgatcacctacttataacgaaatcaatagtgtagtgaacatatatgtg |
35171995 |
T |
 |
Q |
157 |
gtttatcacaacaaaaatatgaatgttgtaacttttggcacacgtgtgctcacgcatatttgaagtaatgtctgaaaaggttcttgttatgtgtcacatg |
256 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
35171996 |
gtttatcacaacaaaaatatgaatgttgtaacttttggcacacgtgtgctcacgcatatttgaagtaatgtctgaaaaggttcttgttatgtgtcacatg |
35172095 |
T |
 |
Q |
257 |
gtatgtggtatatattttacttagcacacttcaaatatttttcagatttttacaactggcataatggatgccctttct |
334 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
35172096 |
gtatgtggtatatattttacttagcacacttcaaatatttttcagatttttacaactggcataatggatgccctttct |
35172173 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 1204 times since January 2019
Visitors: 6138