View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0830_low_77 (Length: 354)
Name: NF0830_low_77
Description: NF0830
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0830_low_77 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 231; Significance: 1e-127; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 231; E-Value: 1e-127
Query Start/End: Original strand, 31 - 335
Target Start/End: Complemental strand, 38287366 - 38287068
Alignment:
| Q |
31 |
ggaaagccaaatcccatatctaagcaataatcaaccgggttcacatatcactaattaattatagacatcatgattataaacttgctggattgtcatcaat |
130 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38287366 |
ggaaagccaaatcccatatctaagcaataatcaaccgggttcacatatcactaattaatcatagacatcatgattataaacttgctggattgtcatcaat |
38287267 |
T |
|
| Q |
131 |
gaa-gcaataaaaataactaataatcttactgttgattgagctttgtgatcgatgcatgagctaatttaaagaaaatttgtctttgtacacaaatacacc |
229 |
Q |
| |
|
||| ||| ||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||| |
|
|
| T |
38287266 |
gaaagcagtaa---taactaataatcttactgttgattgagctttgtgatcgatgcatgagctaatttaaagaaaatttgtctttgtacacaaatatacc |
38287170 |
T |
|
| Q |
230 |
ttattgactctttaagagagaaagaaatnnnnnnnnttatgtgaatatgtgatcgatataattaatatgttgatgataagatacaaagaaaatagagaga |
329 |
Q |
| |
|
|||||||||||||||||||||||||||| |||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38287169 |
ttattgactctttaagagagaaagaaataaaaaaaattatgtgaatatgtgatcgata----taatatgttgatgataagatacaaagaaaatagagaga |
38287074 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 2007 times since January 2019
Visitors: 6156