View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0830_low_80 (Length: 347)
Name: NF0830_low_80
Description: NF0830
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0830_low_80 |
 |  |
|
| [»] scaffold0179 (3 HSPs) |
 |  |  |
|
Alignment Details
Target: chr6 (Bit Score: 86; Significance: 5e-41; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 86; E-Value: 5e-41
Query Start/End: Original strand, 18 - 111
Target Start/End: Complemental strand, 894377 - 894284
Alignment:
| Q |
18 |
gatccctggtggtaacaaagcactttcatggttaattgattccgctaccattgcaatatcgtggtaaaattatatcttatttcttctctcttgc |
111 |
Q |
| |
|
||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
894377 |
gatccctggtggtaacaaatgactttcatggttaattgattccgctaccattgcaatatcgtggtaaaattatatcttatttcttctctcttgc |
894284 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0179 (Bit Score: 65; Significance: 2e-28; HSPs: 3)
Name: scaffold0179
Description:
Target: scaffold0179; HSP #1
Raw Score: 65; E-Value: 2e-28
Query Start/End: Original strand, 135 - 243
Target Start/End: Original strand, 6462 - 6570
Alignment:
| Q |
135 |
tccattcctctcctttctcctctaggataannnnnnnncttctccttttcgcttactaatctttttatagactctatcaatgaatccaccactctcaaca |
234 |
Q |
| |
|
||||| ||||||||||||||||||||||| ||||||||||||||||| ||||||||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
6462 |
tccatccctctcctttctcctctaggatattttttttccttctccttttcgcttattaatctttttatagactctatgaatgaatccaccactctcaaca |
6561 |
T |
 |
| Q |
235 |
ccctgaaaa |
243 |
Q |
| |
|
|||| |||| |
|
|
| T |
6562 |
ccctcaaaa |
6570 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0179; HSP #2
Raw Score: 54; E-Value: 6e-22
Query Start/End: Original strand, 18 - 106
Target Start/End: Original strand, 6343 - 6436
Alignment:
| Q |
18 |
gatccctggtggtaacaaa-----gcactttcatggttaattgattccgctaccattgcaatatcgtggtaaaattatatcttatttcttctct |
106 |
Q |
| |
|
||||||||||||||||||| |||||||||||||| | |||||| ||||||||||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
6343 |
gatccctggtggtaacaaattaaagcactttcatggttgttggattccactaccattgcaatattgtggtaaaattatatcttatttcttctct |
6436 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0179; HSP #3
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 301 - 333
Target Start/End: Original strand, 6629 - 6661
Alignment:
| Q |
301 |
gggtgtttgattattggtgaatttgtgtctgtg |
333 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |
|
|
| T |
6629 |
gggtgtttgattattggtgaatttgtgtctgtg |
6661 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University