View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0830_low_82 (Length: 343)
Name: NF0830_low_82
Description: NF0830
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0830_low_82 |
 | |
|
Alignment Details
Target: chr6 (Bit Score: 221; Significance: 1e-121; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 221; E-Value: 1e-121
Query Start/End: Original strand, 1 - 237
Target Start/End: Original strand, 3892594 - 3892829
Alignment:
| Q |
1 |
agttaaaaaattcatgtattaataatattttttctaaattcatgttgattgatttctttgtttgtttttgttgttataatcacaaattgaaattaatggg |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||| | ||||||||||||||||||||||||||||||||| |
|
|
| T |
3892594 |
agttaaaaaattcatgtattaataatatttt-tctaaattcatgttgattgatttctttgtttggtcttgttgttataatcacaaattgaaattaatggg |
3892692 |
T |
|
| Q |
101 |
atttttatgtttaacttgtctgtttaatgaaacaggacttagtttaatttgtgattaattatgatggatgcaatggagaaaaattcaagagatgttgaga |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3892693 |
atttttatgtttaacttgtctgtttaatgaaacaggacttagtttaatttgtgattaattatgatggatgcaatggagaaaaattcaagagatgttgaga |
3892792 |
T |
|
| Q |
201 |
gtgatgaaaaatttgaattgccacctggatttaggtt |
237 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3892793 |
gtgatgaaaaatttgaattgccacctggatttaggtt |
3892829 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 1734 times since January 2019
Visitors: 6149