View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0830_low_82 (Length: 343)
Name: NF0830_low_82
Description: NF0830
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0830_low_82 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 221; Significance: 1e-121; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 221; E-Value: 1e-121
Query Start/End: Original strand, 1 - 237
Target Start/End: Original strand, 3892594 - 3892829
Alignment:
Q |
1 |
agttaaaaaattcatgtattaataatattttttctaaattcatgttgattgatttctttgtttgtttttgttgttataatcacaaattgaaattaatggg |
100 |
Q |
|
|
||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||| | ||||||||||||||||||||||||||||||||| |
|
|
T |
3892594 |
agttaaaaaattcatgtattaataatatttt-tctaaattcatgttgattgatttctttgtttggtcttgttgttataatcacaaattgaaattaatggg |
3892692 |
T |
 |
Q |
101 |
atttttatgtttaacttgtctgtttaatgaaacaggacttagtttaatttgtgattaattatgatggatgcaatggagaaaaattcaagagatgttgaga |
200 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
3892693 |
atttttatgtttaacttgtctgtttaatgaaacaggacttagtttaatttgtgattaattatgatggatgcaatggagaaaaattcaagagatgttgaga |
3892792 |
T |
 |
Q |
201 |
gtgatgaaaaatttgaattgccacctggatttaggtt |
237 |
Q |
|
|
||||||||||||||||||||||||||||||||||||| |
|
|
T |
3892793 |
gtgatgaaaaatttgaattgccacctggatttaggtt |
3892829 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University