View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0830_low_83 (Length: 343)
Name: NF0830_low_83
Description: NF0830
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0830_low_83 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 165; Significance: 3e-88; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 165; E-Value: 3e-88
Query Start/End: Original strand, 30 - 267
Target Start/End: Complemental strand, 29056918 - 29056682
Alignment:
| Q |
30 |
gatagtgtgattgcattgatagataaaggatcctcttgctcttatatcttccagtattcactattcaagaaggtgagagagtccaaagggtggtgtcaac |
129 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
29056918 |
gatagtgtgattgcattgatagataaaggatcctcttgctcttatatcttccagtattcactattcaaggaggtgagagagtccaaagggtggtgtcaac |
29056819 |
T |
|
| Q |
130 |
gttatctttaannnnnnnnnnnnnnnnnnnccttcaaaaggttattacttttcataactggctctcatgatggccagaggatgcattgaagtttttgtga |
229 |
Q |
| |
|
||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||| | |
|
|
| T |
29056818 |
gttatctttaatttttcttttaacttttttccttcaaaaggttattacttttcataactggctctcatgatggccagaggatgcattgaag-ttttgtaa |
29056720 |
T |
|
| Q |
230 |
tttcggataattgaacaatggtaccacctatctctgct |
267 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| |
|
|
| T |
29056719 |
tttcggataattgaacaatggtaccacctatctctgct |
29056682 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 697 times since January 2019
Visitors: 6130