View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0830_low_89 (Length: 332)
Name: NF0830_low_89
Description: NF0830
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0830_low_89 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 68; Significance: 2e-30; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 68; E-Value: 2e-30
Query Start/End: Original strand, 241 - 320
Target Start/End: Complemental strand, 28524214 - 28524135
Alignment:
| Q |
241 |
tgaattcataaacttgaaggaaacaaatgtgctgattgattgactaattttagtctatccaatgattcttttgatgttca |
320 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |||||||||||||||||| |||||||| |||||||||||||||| |
|
|
| T |
28524214 |
tgaattcataaacttgaaggaaacaaatgtgctgactgattgactaattttagtttatccaataattcttttgatgttca |
28524135 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 1342 times since January 2019
Visitors: 6140