View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF0830_low_91 (Length: 321)

Name: NF0830_low_91
Description: NF0830
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF0830_low_91
NF0830_low_91
[»] chr4 (1 HSPs)
chr4 (154-243)||(51456598-51456687)


Alignment Details
Target: chr4 (Bit Score: 86; Significance: 4e-41; HSPs: 1)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 86; E-Value: 4e-41
Query Start/End: Original strand, 154 - 243
Target Start/End: Complemental strand, 51456687 - 51456598
Alignment:
154 ttgttagaatatctctagacttatatgattcaataattttaacggttgatatttgaataagccaaaacagattactctccatgttctaaa 243  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||    
51456687 ttgttagaatatctctagacttatatgattcaataattttaacggttgagatttgaataagccaaaacagattactctccatgttctaaa 51456598  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University

This website was viewed 1317 times since January 2019
Visitors: 6140