View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0830_low_93 (Length: 317)
Name: NF0830_low_93
Description: NF0830
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0830_low_93 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 233; Significance: 1e-129; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 233; E-Value: 1e-129
Query Start/End: Original strand, 56 - 304
Target Start/End: Original strand, 42238773 - 42239021
Alignment:
Q |
56 |
aaaatctaccacattaagacaggatgaaagctaggaaaccaaaggttgaaacaaacaaccagaagaaaataaataattatataagttattcgttttcttc |
155 |
Q |
|
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||| ||||||||||| |
|
|
T |
42238773 |
aaaatctaccacattaagacaggatgaaagctaggaaaccaaaggttgaaacaaacaaccagaagaaaataaatagttatataagttactcgttttcttc |
42238872 |
T |
 |
Q |
156 |
gggtatagaatccaatattggcttccgatcacatgtcaaactaacaccatctgttttaacaattgataatagttcctgtaatgacatttctttggtcact |
255 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||| |
|
|
T |
42238873 |
gggtatagaatccaatattggcttccgatcacatgtcaaactaacaccatctgttttaacaactgataatagttcctgtaatgacatttctttggtcact |
42238972 |
T |
 |
Q |
256 |
aactgttgaagctgctgtttcgttattaaaactttgattctctttgtct |
304 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||| |||||||||| |
|
|
T |
42238973 |
aactgttgaagctgctgtttcgttattaaaactttgatcctctttgtct |
42239021 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University