View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0830_low_98 (Length: 310)
Name: NF0830_low_98
Description: NF0830
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0830_low_98 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 199; Significance: 1e-108; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 199; E-Value: 1e-108
Query Start/End: Original strand, 1 - 223
Target Start/End: Original strand, 6791130 - 6791352
Alignment:
Q |
1 |
tgattcagccctaaaagaaagatagcccagcttactgaattggcaattgtttcctttcctgtcaaatagaaatttttacaattatctataatctcttcca |
100 |
Q |
|
|
|||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| |
|
|
T |
6791130 |
tgattcagccctaaaagaaagatagcccagctcactgaattggcaattgtttcctttcctgtcaaatagaaatttttacaattatctataatctcatcca |
6791229 |
T |
 |
Q |
101 |
atcctagcctttgtgtcttattgttgataaatttatgacgagacatcaacaaagcaagcaaattttctgaattgttttgtgttttatggttattgtcaat |
200 |
Q |
|
|
|||||||||||||||||| ||||||||||||||| ||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
6791230 |
atcctagcctttgtgtctcattgttgataaatttgtgaggagacatcaacaaagcaagcaaattttctgaattgttttgtgttttatggttattgtcaat |
6791329 |
T |
 |
Q |
201 |
caacacttgaattagttcacgag |
223 |
Q |
|
|
|||||||| |||||||||||||| |
|
|
T |
6791330 |
caacactttaattagttcacgag |
6791352 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University