View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0830_low_99 (Length: 306)
Name: NF0830_low_99
Description: NF0830
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0830_low_99 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 184; Significance: 1e-99; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 184; E-Value: 1e-99
Query Start/End: Original strand, 36 - 277
Target Start/End: Original strand, 29519629 - 29519878
Alignment:
Q |
36 |
tgagtaacttgttcagctgttgtagaggatccaaatccacttggtccagccatgcccgtaaccaacgagaaaatacccaccattttgattctgaagagaa |
135 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
29519629 |
tgagtaacttgttcagctgttgtagaggatccaaatccacttggtccagccatgcccgtaaccaacgagaaaatacccaccattttgattctgaagagaa |
29519728 |
T |
 |
Q |
136 |
caatcaaataaatctctcttgattgaaagctctaagttattataaattattttttccttgatgtg------------tatatatatacaaatgaagataa |
223 |
Q |
|
|
||||||||||||||||||||||||||||||||||| |||| |||||||||||||||||||| ||||||||||||||||||||||| |
|
|
T |
29519729 |
taatcaaataaatctctcttgattgaaagctctaagctatt----attattttttccttgatgtgtgtatatatatatatatatatacaaatgaagataa |
29519824 |
T |
 |
Q |
224 |
cgtgtgggatgaatataatatgattgagataagaagaaagaagaattaatgagg |
277 |
Q |
|
|
||||||||||||||| |||||||||||||||||||||||||||||||||||||| |
|
|
T |
29519825 |
cgtgtgggatgaataaaatatgattgagataagaagaaagaagaattaatgagg |
29519878 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 2286 times since January 2019
Visitors: 6161