View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0831_high_27 (Length: 383)
Name: NF0831_high_27
Description: NF0831
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0831_high_27 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 296; Significance: 1e-166; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 296; E-Value: 1e-166
Query Start/End: Original strand, 72 - 371
Target Start/End: Complemental strand, 47286796 - 47286497
Alignment:
| Q |
72 |
cgacattgccacaaatacattccgatccttaactgtacaaacagacacttggtgttcctcaggttctgttctctcaaacggtacattagtccaaaccggt |
171 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47286796 |
cgacattgccacaaatacattccgatccttaactgtacaaacagacacttggtgttcctcaggttctgttctctcaaacggtacattagtccaaaccggt |
47286697 |
T |
|
| Q |
172 |
ggtttcaacgatggtgagcgtcgaattcgaatgttcacaccatgtttcaacgaaaattgtgattggattgaattcccaagttacttatccgaaagaagat |
271 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47286696 |
ggtttcaacgatggtgagcgtcgaattcgaatgttcacaccatgtttcaacgaaaattgtgattggattgaattcccaagttacttatccgaaagaagat |
47286597 |
T |
|
| Q |
272 |
ggtatgcaacaaatcaaatactaccagataatcgcattataattattggtggtagaagacaattcaactatgaattcattcctaaaacaacgacctcttc |
371 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
47286596 |
ggtatgcaacaaatcaaatactaccagataatcgcattataattattggtggtagaagacaattcaactatgaattcattcctaaaacaacgacttcttc |
47286497 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 61; E-Value: 4e-26
Query Start/End: Original strand, 6 - 66
Target Start/End: Complemental strand, 47286973 - 47286913
Alignment:
| Q |
6 |
acaaccaaccattggcatttcagctatgcacatgcaactttcacacaacaataaaatcata |
66 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47286973 |
acaaccaaccattggcatttcagctatgcacatgcaactttcacacaacaataaaatcata |
47286913 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 1854 times since January 2019
Visitors: 6150