View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF0831_high_40 (Length: 310)

Name: NF0831_high_40
Description: NF0831
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF0831_high_40
NF0831_high_40
[»] chr3 (1 HSPs)
chr3 (69-310)||(24568156-24568397)


Alignment Details
Target: chr3 (Bit Score: 230; Significance: 1e-127; HSPs: 1)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 230; E-Value: 1e-127
Query Start/End: Original strand, 69 - 310
Target Start/End: Complemental strand, 24568397 - 24568156
Alignment:
69 atcataggggctaaagcatattctaactttgaatatcgcaaacttttgcacaatttggaattataatataattgcagataccagatagaatatgtgaagg 168  Q
    ||||||||||||||||||||||||| |||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
24568397 atcataggggctaaagcatattctacctttgaatattgcaaacttttgcacaatttggaattataatataattgcagataccagatagaatatgtgaagg 24568298  T
169 acggtttgcactcattagaaggccttaattgttcgatattggtgtcttccctttcacacggttgtggtcccttatttgttgggcatgatcatatattaca 268  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||    
24568297 acggtttgcactcattagaaggccttaattgttcgatattggtgtcttctctttcacacggttgtggtcccttatttgttgggcatgatcatatattaca 24568198  T
269 tgttcattcatatgtacatccccatgcacattatacattact 310  Q
    ||||||||||||||||||||||||||||||||||||||||||    
24568197 tgttcattcatatgtacatccccatgcacattatacattact 24568156  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University

This website was viewed 3229 times since January 2019
Visitors: 6172