View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0831_high_47 (Length: 289)
Name: NF0831_high_47
Description: NF0831
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0831_high_47 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 59; Significance: 5e-25; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 59; E-Value: 5e-25
Query Start/End: Original strand, 1 - 71
Target Start/End: Complemental strand, 27844772 - 27844702
Alignment:
Q |
1 |
tcttaaaaattctcactttaaaattttatttagtctaatggattaattattagaggtggaaattgagttca |
71 |
Q |
|
|
|||| |||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||| |
|
|
T |
27844772 |
tcttcaaaattctcactttaaaattttatttagtcctatggattaattattagaggtggaaattgagttca |
27844702 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 171 - 206
Target Start/End: Complemental strand, 27844607 - 27844572
Alignment:
Q |
171 |
tatttaccaaacaagatatgccgcaaatagaaagat |
206 |
Q |
|
|
|||||||||||||||||||||||||||||||||||| |
|
|
T |
27844607 |
tatttaccaaacaagatatgccgcaaatagaaagat |
27844572 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University