View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF0831_high_47 (Length: 289)

Name: NF0831_high_47
Description: NF0831
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF0831_high_47
NF0831_high_47
[»] chr8 (2 HSPs)
chr8 (1-71)||(27844702-27844772)
chr8 (171-206)||(27844572-27844607)


Alignment Details
Target: chr8 (Bit Score: 59; Significance: 5e-25; HSPs: 2)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 59; E-Value: 5e-25
Query Start/End: Original strand, 1 - 71
Target Start/End: Complemental strand, 27844772 - 27844702
Alignment:
1 tcttaaaaattctcactttaaaattttatttagtctaatggattaattattagaggtggaaattgagttca 71  Q
    |||| ||||||||||||||||||||||||||||||  ||||||||||||||||||||||||||||||||||    
27844772 tcttcaaaattctcactttaaaattttatttagtcctatggattaattattagaggtggaaattgagttca 27844702  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #2
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 171 - 206
Target Start/End: Complemental strand, 27844607 - 27844572
Alignment:
171 tatttaccaaacaagatatgccgcaaatagaaagat 206  Q
    ||||||||||||||||||||||||||||||||||||    
27844607 tatttaccaaacaagatatgccgcaaatagaaagat 27844572  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University

This website was viewed 3110 times since January 2019
Visitors: 6169