View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0831_high_51 (Length: 276)
Name: NF0831_high_51
Description: NF0831
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0831_high_51 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 148; Significance: 4e-78; HSPs: 4)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 148; E-Value: 4e-78
Query Start/End: Original strand, 27 - 261
Target Start/End: Complemental strand, 32809304 - 32809066
Alignment:
| Q |
27 |
tcaactctatcatattcaacttcatctatcatttatctccctctcaccaatcttacaaatatatataccacaatgtgagagactcacatggtcaagttat |
126 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32809304 |
tcaactctatcatattcaacttcatctatcatttatctccctctcaccaatcttacaaatatatataccacaatgtgagagactcacatggtcaagttat |
32809205 |
T |
 |
| Q |
127 |
tttgcttcaaccttttttctcaagtatggaggagcctcacgacaaggagaacac-aca----tggtgtgcaatgaccgtcaaggctgcaaggttgggcat |
221 |
Q |
| |
|
||||||||||||| |||||||||||||||||||||||||||||||||||| ||| ||| ||| | |||| | | |||||||||| |||||||| |
|
|
| T |
32809204 |
tttgcttcaacct-ttttctcaagtatggaggagcctcacgacaaggagaccacaacaccgttggag-gcaaggtgtgcaaaggctgcaaccttgggcat |
32809107 |
T |
 |
| Q |
222 |
gggtggaatcggtaaacaggtagtga-atctatctctgcat |
261 |
Q |
| |
|
|||||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
32809106 |
gggtggaatcggtaaacaggtagtgatctctatctctgcat |
32809066 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 73; E-Value: 2e-33
Query Start/End: Original strand, 146 - 261
Target Start/End: Complemental strand, 32275452 - 32275324
Alignment:
| Q |
146 |
tcaagtatggaggagcctcacgacaaggagaacaca-------------catggtgtgcaatgaccgtcaaggctgcaaggttgggcatgggtggaatcg |
232 |
Q |
| |
|
||||||||||||||||||||||||||||||||| || || |||||||||||||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
32275452 |
tcaagtatggaggagcctcacgacaaggagaacccaacaccgttggaggcaaggtgtgcaatgaccgtcaaggctgcaagcttgggcatgggtggaatcg |
32275353 |
T |
 |
| Q |
233 |
gtaaacaggtagtgaatctatctctgcat |
261 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
32275352 |
gtaaacaggtagtgaatctatctctgcat |
32275324 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #3
Raw Score: 67; E-Value: 8e-30
Query Start/End: Original strand, 124 - 253
Target Start/End: Complemental strand, 32269165 - 32269024
Alignment:
| Q |
124 |
tattttgcttcaaccttttttctcaagtatggaggagcctcacgacaaggagaacaca-ca----tgg-------tgtgcaatgaccgtcaaggctgcaa |
211 |
Q |
| |
|
|||||| ||| ||||||||||||||||||||||||||||||||||||| ||||||||| || ||| ||||||||||||||||||| ||||| |
|
|
| T |
32269165 |
tatttttcttaaaccttttttctcaagtatggaggagcctcacgacaaagagaacacaacaccgttggaggcaagtgtgcaatgaccgtcaaggttgcaa |
32269066 |
T |
 |
| Q |
212 |
ggttgggcatgggtggaatcggtaaacaggtagtgaatctat |
253 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32269065 |
ccttgggcatgggtggaatcggtaaacaggtagtgaatctat |
32269024 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #4
Raw Score: 57; E-Value: 7e-24
Query Start/End: Original strand, 27 - 91
Target Start/End: Complemental strand, 32269239 - 32269175
Alignment:
| Q |
27 |
tcaactctatcatattcaacttcatctatcatttatctccctctcaccaatcttacaaatatata |
91 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||| |||| |
|
|
| T |
32269239 |
tcaactctatcatattcaacttcatctatcatttatctccctctcaccagtcttacaaatttata |
32269175 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University