View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0831_high_58 (Length: 252)
Name: NF0831_high_58
Description: NF0831
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0831_high_58 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 209; Significance: 1e-114; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 209; E-Value: 1e-114
Query Start/End: Original strand, 1 - 241
Target Start/End: Complemental strand, 45097289 - 45097054
Alignment:
Q |
1 |
gtttaggcccctcgcagtttgtggtggcattttctgaaattgcaattcttagtttttaggtccttttaatttgcctgcaatttagggatctcaaatgttc |
100 |
Q |
|
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||| |
|
|
T |
45097289 |
gtttaggcccctcgcagtttgtggtggcattttctgaaattgcaattcttagtttttaggtcctttt-----gcctgcaatttagggatctcaaatgttc |
45097195 |
T |
 |
Q |
101 |
ttaatactgaactcattggtgctacaaatgcagcataaagtgctcatgagaaatatgcttgttttcttggctttcaagtcttctaaggttgtcccttggc |
200 |
Q |
|
|
||||||||||||||||||||||||| ||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| |
|
|
T |
45097194 |
ttaatactgaactcattggtgctacgaatgcagcatagagtgctcatgagaaatatgcttgttttcttggctttcaagtcttctaaggttgtcccgtggc |
45097095 |
T |
 |
Q |
201 |
cgttgattgaagaacagatgagagaattgtctctatttcat |
241 |
Q |
|
|
||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
45097094 |
cgttgattgaagaacagatgagagaattgtctctatttcat |
45097054 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6 (Bit Score: 38; Significance: 0.000000000001; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 159 - 200
Target Start/End: Complemental strand, 11775932 - 11775891
Alignment:
Q |
159 |
ttgttttcttggctttcaagtcttctaaggttgtcccttggc |
200 |
Q |
|
|
|||||||||| ||||||||||||||||||||||||||||||| |
|
|
T |
11775932 |
ttgttttcttagctttcaagtcttctaaggttgtcccttggc |
11775891 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 1669 times since January 2019
Visitors: 6148