View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF0831_high_64 (Length: 241)

Name: NF0831_high_64
Description: NF0831
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF0831_high_64
NF0831_high_64
[»] chr1 (1 HSPs)
chr1 (69-226)||(13854206-13854363)


Alignment Details
Target: chr1 (Bit Score: 150; Significance: 2e-79; HSPs: 1)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 150; E-Value: 2e-79
Query Start/End: Original strand, 69 - 226
Target Start/End: Complemental strand, 13854363 - 13854206
Alignment:
69 atgtcttcaatatgaattgcaagtgctacatagattatcactgattgaagttgattgtaacttagtataatacattatcatacagtgatgcacttttctc 168  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||    
13854363 atgtcttcaatatgaattgcaagtgctacatagattatcactgattgaagttgattgtaacttagtataatacattatcatacaatgatgcacttttctc 13854264  T
169 tcaaaactccaattcaaataaatgcttttaactagattattttgtcaatgcttaaagt 226  Q
    |||||||||| |||||||||||||||||||||||||||||||||||||||||||||||    
13854263 tcaaaactccgattcaaataaatgcttttaactagattattttgtcaatgcttaaagt 13854206  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University