View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF0831_high_65 (Length: 241)

Name: NF0831_high_65
Description: NF0831
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF0831_high_65
NF0831_high_65
[»] chr7 (1 HSPs)
chr7 (1-181)||(47286729-47286909)


Alignment Details
Target: chr7 (Bit Score: 177; Significance: 2e-95; HSPs: 1)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 177; E-Value: 2e-95
Query Start/End: Original strand, 1 - 181
Target Start/End: Complemental strand, 47286909 - 47286729
Alignment:
1 ttcgatcgaaccgattttggcccttcaaatctccctctttcaaatggccggtgtcgtatggatccattcgacactgcccttaaaattgattgcactgctc 100  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
47286909 ttcgatcgaaccgattttggcccttcaaatctccctctttcaaatggccggtgtcgtatggatccattcgacactgcccttaaaattgattgcactgctc 47286810  T
101 actctgttctatacgacattgccacaaatacattccgatccttaactgtacaaacagacacttggtgttccacaggttctg 181  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||    
47286809 actctgttctatacgacattgccacaaatacattccgatccttaactgtacaaacagacacttggtgttcctcaggttctg 47286729  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University