View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0831_high_70 (Length: 212)
Name: NF0831_high_70
Description: NF0831
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0831_high_70 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 110; Significance: 1e-55; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 110; E-Value: 1e-55
Query Start/End: Original strand, 1 - 114
Target Start/End: Complemental strand, 50208305 - 50208192
Alignment:
| Q |
1 |
tatgagaagattcacaatttactttaaaatatggacttgaaacggatataatattcagtaaatttttaaatttggttctgatgtagaactattatatact |
100 |
Q |
| |
|
|||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
50208305 |
tatgagaagattcacaatttacttcaaaatatggacttgaaacggatataatattcagtaaatttttaaatttggttctgatgtagaactattatatact |
50208206 |
T |
|
| Q |
101 |
tgttgtcaggcaca |
114 |
Q |
| |
|
|||||||||||||| |
|
|
| T |
50208205 |
tgttgtcaggcaca |
50208192 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 3029 times since January 2019
Visitors: 6168