View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF0831_high_70 (Length: 212)

Name: NF0831_high_70
Description: NF0831
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF0831_high_70
NF0831_high_70
[»] chr3 (1 HSPs)
chr3 (1-114)||(50208192-50208305)


Alignment Details
Target: chr3 (Bit Score: 110; Significance: 1e-55; HSPs: 1)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 110; E-Value: 1e-55
Query Start/End: Original strand, 1 - 114
Target Start/End: Complemental strand, 50208305 - 50208192
Alignment:
1 tatgagaagattcacaatttactttaaaatatggacttgaaacggatataatattcagtaaatttttaaatttggttctgatgtagaactattatatact 100  Q
    |||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
50208305 tatgagaagattcacaatttacttcaaaatatggacttgaaacggatataatattcagtaaatttttaaatttggttctgatgtagaactattatatact 50208206  T
101 tgttgtcaggcaca 114  Q
    ||||||||||||||    
50208205 tgttgtcaggcaca 50208192  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University