View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0831_low_18 (Length: 483)
Name: NF0831_low_18
Description: NF0831
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0831_low_18 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 144; Significance: 2e-75; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 144; E-Value: 2e-75
Query Start/End: Original strand, 149 - 312
Target Start/End: Complemental strand, 25744027 - 25743864
Alignment:
Q |
149 |
gatgtatggaatcaaaactgcataagccgggaaactttgaagaatccatttgtgtatggtgctcctggaagtaagattattgtaacaacaagaattgctc |
248 |
Q |
|
|
||||||||||||||||||| ||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
25744027 |
gatgtatggaatcaaaactacataagctgggaaactttgaagaatccatttgtgtatggtgctcctggaagtaagattattgtaacaacaagaattgctc |
25743928 |
T |
 |
Q |
249 |
atgtggcatcaattatgcagactgttgagcctaattatctttcagaactgtgtgatgatgattg |
312 |
Q |
|
|
| |||||||||||||||||||||||||||||| |||||||||||||||| |||||||||||||| |
|
|
T |
25743927 |
acgtggcatcaattatgcagactgttgagccttattatctttcagaactttgtgatgatgattg |
25743864 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 90; E-Value: 3e-43
Query Start/End: Original strand, 308 - 421
Target Start/End: Complemental strand, 25743762 - 25743649
Alignment:
Q |
308 |
gattgccatcggctgtgaagacacttgcaggacttctgagatctaaagatgatacaagggaatggtacaaagtactaaacagtgagatatgggatttgca |
407 |
Q |
|
|
||||||| | ||| |||||||||||||| ||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
25743762 |
gattgcctttggccgtgaagacacttgcgggacttctgagatgtaaagatgatacaagggaatggtacaaagtactaaacagtgagatatgggatttgca |
25743663 |
T |
 |
Q |
408 |
ggatgatgagagta |
421 |
Q |
|
|
| |||||||||||| |
|
|
T |
25743662 |
gaatgatgagagta |
25743649 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 35; Significance: 0.0000000002; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 308 - 402
Target Start/End: Original strand, 18085658 - 18085752
Alignment:
Q |
308 |
gattgccatcggctgtgaagacacttgcaggacttctgagatctaaagatgatacaagggaatggtacaaagtactaaacagtgagatatgggat |
402 |
Q |
|
|
||||||| | |||| |||||||||||||||||||| ||||||| ||| ||||| |||||| | |||||||| |||||||||||||||||| |
|
|
T |
18085658 |
gattgcctttggctttgaagacacttgcaggacttttgagatcaaaaagtgatattcaagaatggcataaagtactgaacagtgagatatgggat |
18085752 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University