View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF0831_low_18 (Length: 483)

Name: NF0831_low_18
Description: NF0831
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF0831_low_18
NF0831_low_18
[»] chr2 (2 HSPs)
chr2 (149-312)||(25743864-25744027)
chr2 (308-421)||(25743649-25743762)
[»] chr1 (1 HSPs)
chr1 (308-402)||(18085658-18085752)


Alignment Details
Target: chr2 (Bit Score: 144; Significance: 2e-75; HSPs: 2)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 144; E-Value: 2e-75
Query Start/End: Original strand, 149 - 312
Target Start/End: Complemental strand, 25744027 - 25743864
Alignment:
149 gatgtatggaatcaaaactgcataagccgggaaactttgaagaatccatttgtgtatggtgctcctggaagtaagattattgtaacaacaagaattgctc 248  Q
    ||||||||||||||||||| ||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
25744027 gatgtatggaatcaaaactacataagctgggaaactttgaagaatccatttgtgtatggtgctcctggaagtaagattattgtaacaacaagaattgctc 25743928  T
249 atgtggcatcaattatgcagactgttgagcctaattatctttcagaactgtgtgatgatgattg 312  Q
    | |||||||||||||||||||||||||||||| |||||||||||||||| ||||||||||||||    
25743927 acgtggcatcaattatgcagactgttgagccttattatctttcagaactttgtgatgatgattg 25743864  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #2
Raw Score: 90; E-Value: 3e-43
Query Start/End: Original strand, 308 - 421
Target Start/End: Complemental strand, 25743762 - 25743649
Alignment:
308 gattgccatcggctgtgaagacacttgcaggacttctgagatctaaagatgatacaagggaatggtacaaagtactaaacagtgagatatgggatttgca 407  Q
    ||||||| | ||| |||||||||||||| ||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
25743762 gattgcctttggccgtgaagacacttgcgggacttctgagatgtaaagatgatacaagggaatggtacaaagtactaaacagtgagatatgggatttgca 25743663  T
408 ggatgatgagagta 421  Q
    | ||||||||||||    
25743662 gaatgatgagagta 25743649  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1 (Bit Score: 35; Significance: 0.0000000002; HSPs: 1)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 308 - 402
Target Start/End: Original strand, 18085658 - 18085752
Alignment:
308 gattgccatcggctgtgaagacacttgcaggacttctgagatctaaagatgatacaagggaatggtacaaagtactaaacagtgagatatgggat 402  Q
    ||||||| | |||| |||||||||||||||||||| ||||||| |||  |||||     |||||| | |||||||| ||||||||||||||||||    
18085658 gattgcctttggctttgaagacacttgcaggacttttgagatcaaaaagtgatattcaagaatggcataaagtactgaacagtgagatatgggat 18085752  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University

This website was viewed 2092 times since January 2019
Visitors: 6156