View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0831_low_26 (Length: 432)
Name: NF0831_low_26
Description: NF0831
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0831_low_26 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 217; Significance: 1e-119; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 217; E-Value: 1e-119
Query Start/End: Original strand, 9 - 273
Target Start/End: Complemental strand, 10530382 - 10530119
Alignment:
| Q |
9 |
gattatactaaaatctaatgtttattagagcaatattttaatgattgtgagtaataatcgaccgtggaccagagttcgctctagaagccgacgttgtcta |
108 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| |||||||||||||||| |||||| |
|
|
| T |
10530382 |
gattatactaaaatctaatgtttattagagcaatattttaatgattgtgagtaataatcgaccgtggaccacagtttgctctagaagccgacgctgtcta |
10530283 |
T |
|
| Q |
109 |
tttgttcttactgactcgacnnnnnnnnnccttttgtgttcattgatggatttgagtcgatgtgttatcccatacttgtttagttggttaaaacttgtgc |
208 |
Q |
| |
|
|||||||||||||||||||| |||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
10530282 |
tttgttcttactgactcgactttttttt-ccttttctgttcattgatggatttgagtcgatgtgttatcccatacttgtttagttggttaaaacttgtgc |
10530184 |
T |
|
| Q |
209 |
ctatccttttctcttgaatggttcttcatgattaaaaccggtaagcatgcagtacataggtgtaa |
273 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
10530183 |
ctatccttttctcttgaatggttcttcatgattaaaaccggtaagcatgcagtacataggtgtaa |
10530119 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 233 times since January 2019
Visitors: 6127