View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF0831_low_37 (Length: 383)

Name: NF0831_low_37
Description: NF0831
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF0831_low_37
NF0831_low_37
[»] chr7 (2 HSPs)
chr7 (72-371)||(47286497-47286796)
chr7 (6-66)||(47286913-47286973)


Alignment Details
Target: chr7 (Bit Score: 296; Significance: 1e-166; HSPs: 2)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 296; E-Value: 1e-166
Query Start/End: Original strand, 72 - 371
Target Start/End: Complemental strand, 47286796 - 47286497
Alignment:
72 cgacattgccacaaatacattccgatccttaactgtacaaacagacacttggtgttcctcaggttctgttctctcaaacggtacattagtccaaaccggt 171  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
47286796 cgacattgccacaaatacattccgatccttaactgtacaaacagacacttggtgttcctcaggttctgttctctcaaacggtacattagtccaaaccggt 47286697  T
172 ggtttcaacgatggtgagcgtcgaattcgaatgttcacaccatgtttcaacgaaaattgtgattggattgaattcccaagttacttatccgaaagaagat 271  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
47286696 ggtttcaacgatggtgagcgtcgaattcgaatgttcacaccatgtttcaacgaaaattgtgattggattgaattcccaagttacttatccgaaagaagat 47286597  T
272 ggtatgcaacaaatcaaatactaccagataatcgcattataattattggtggtagaagacaattcaactatgaattcattcctaaaacaacgacctcttc 371  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||    
47286596 ggtatgcaacaaatcaaatactaccagataatcgcattataattattggtggtagaagacaattcaactatgaattcattcctaaaacaacgacttcttc 47286497  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #2
Raw Score: 61; E-Value: 4e-26
Query Start/End: Original strand, 6 - 66
Target Start/End: Complemental strand, 47286973 - 47286913
Alignment:
6 acaaccaaccattggcatttcagctatgcacatgcaactttcacacaacaataaaatcata 66  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
47286973 acaaccaaccattggcatttcagctatgcacatgcaactttcacacaacaataaaatcata 47286913  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University