View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0831_low_53 (Length: 310)
Name: NF0831_low_53
Description: NF0831
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0831_low_53 |
 |  |
|
| [»] chr3 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 230; Significance: 1e-127; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 230; E-Value: 1e-127
Query Start/End: Original strand, 69 - 310
Target Start/End: Complemental strand, 24568397 - 24568156
Alignment:
| Q |
69 |
atcataggggctaaagcatattctaactttgaatatcgcaaacttttgcacaatttggaattataatataattgcagataccagatagaatatgtgaagg |
168 |
Q |
| |
|
||||||||||||||||||||||||| |||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
24568397 |
atcataggggctaaagcatattctacctttgaatattgcaaacttttgcacaatttggaattataatataattgcagataccagatagaatatgtgaagg |
24568298 |
T |
 |
| Q |
169 |
acggtttgcactcattagaaggccttaattgttcgatattggtgtcttccctttcacacggttgtggtcccttatttgttgggcatgatcatatattaca |
268 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
24568297 |
acggtttgcactcattagaaggccttaattgttcgatattggtgtcttctctttcacacggttgtggtcccttatttgttgggcatgatcatatattaca |
24568198 |
T |
 |
| Q |
269 |
tgttcattcatatgtacatccccatgcacattatacattact |
310 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
24568197 |
tgttcattcatatgtacatccccatgcacattatacattact |
24568156 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University