View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0831_low_58 (Length: 303)
Name: NF0831_low_58
Description: NF0831
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0831_low_58 |
 | |
|
| [»] chr7 (1 HSPs) |
| |
|
Alignment Details
Target: chr7 (Bit Score: 262; Significance: 1e-146; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 262; E-Value: 1e-146
Query Start/End: Original strand, 30 - 303
Target Start/End: Original strand, 6258321 - 6258594
Alignment:
| Q |
30 |
ccaaactcagttactaaggttgttggagttggaagaagaggtggaaaatggaacatgacagttaataacagtggtgaaaataattcaattacaacaacta |
129 |
Q |
| |
|
||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||| ||||||| |
|
|
| T |
6258321 |
ccaaattcagttactaaggttgttggagttggaagaagaggtggaaaatggaacatgacagttaataacaatggtgaaaataattcaattactacaacta |
6258420 |
T |
|
| Q |
130 |
ccacacactttgatgataacaaggttgtagattcagcttcaaaagttgtgagaaatttctatgagggaatcaatgcacatgatgttgattctgtacaata |
229 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6258421 |
ccacacactttgatgataacaaggttgtagattcagcttcaaaagttgtgagaaatttctatgagggaatcaatgcacatgatgttgattctgtacaata |
6258520 |
T |
|
| Q |
230 |
tcttatctctgaaaattgtgtgtatgaggatcttgtctttccacgtccatttgtgggtcgtaaggtattttgct |
303 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6258521 |
tcttatctctgaaaattgtgtgtatgaggatcttgtctttccacgtccatttgtgggtcgtaaggtattttgct |
6258594 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 1163 times since January 2019
Visitors: 6137