View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF0831_low_59 (Length: 298)

Name: NF0831_low_59
Description: NF0831
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF0831_low_59
NF0831_low_59
[»] chr2 (1 HSPs)
chr2 (88-142)||(3438817-3438871)


Alignment Details
Target: chr2 (Bit Score: 39; Significance: 0.0000000000004; HSPs: 1)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 39; E-Value: 0.0000000000004
Query Start/End: Original strand, 88 - 142
Target Start/End: Complemental strand, 3438871 - 3438817
Alignment:
88 gcaagagttttgcttgccagctttctaattttgtgtttaacctatcaaacaagta 142  Q
    ||||||| |||||||||||||||||||||||||||||| ||| | ||||||||||    
3438871 gcaagagctttgcttgccagctttctaattttgtgttttacccaacaaacaagta 3438817  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University