View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0831_low_62 (Length: 285)
Name: NF0831_low_62
Description: NF0831
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0831_low_62 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 178; Significance: 5e-96; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 178; E-Value: 5e-96
Query Start/End: Original strand, 64 - 241
Target Start/End: Complemental strand, 43614462 - 43614285
Alignment:
| Q |
64 |
aaattcccactcaatgcggtctttgtagattgggtctagaaggacttgatctgcaagaattgcccactcctcaaactcgcgtgctcgtaagttttttgaa |
163 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43614462 |
aaattcccactcaatgcggtctttgtagattgggtctagaaggacttgatctgcaagaattgcccactcctcaaactcgcgtgctcgtaagttttttgaa |
43614363 |
T |
|
| Q |
164 |
acccacttgaggtagcttgacggaaggcttcccaacatcttccccttgtattttccgaaatctattactctgtctctg |
241 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43614362 |
acccacttgaggtagcttgacggaaggcttcccaacatcttccccttgtattttccgaaatctattactctgtctctg |
43614285 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 1753 times since January 2019
Visitors: 6149