View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0831_low_70 (Length: 265)
Name: NF0831_low_70
Description: NF0831
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0831_low_70 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 221; Significance: 1e-122; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 221; E-Value: 1e-122
Query Start/End: Original strand, 12 - 236
Target Start/End: Complemental strand, 39620677 - 39620453
Alignment:
| Q |
12 |
gcagagagagcagttttctatagggaaaatgctgccagaatgtattctcctctggcatatgcttttggtcaggcaagtggttttctttagtctttactta |
111 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39620677 |
gcagagagagcagttttctatagggaaaatgctgccagaatgtattctccactggcatatgcttttggtcaggcaagtggttttctttagtctttactta |
39620578 |
T |
|
| Q |
112 |
tattctcatataaataaatgacttgcttcggtatctatgtttctttataatccaatcttcatattttcatgcaggctctaatcgaaatttcgtatgttct |
211 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39620577 |
tattctcatataaataaatgacttgcttcggtatctatgtttctttataatccaatcttcatattttcatgcaggctctaatcgaaatttcgtatgttct |
39620478 |
T |
|
| Q |
212 |
tttacaagctttggtctatggaact |
236 |
Q |
| |
|
||||||||||||||||||||||||| |
|
|
| T |
39620477 |
tttacaagctttggtctatggaact |
39620453 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 2196 times since January 2019
Visitors: 6159