View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF0831_low_72 (Length: 256)

Name: NF0831_low_72
Description: NF0831
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF0831_low_72
NF0831_low_72
[»] chr7 (1 HSPs)
chr7 (24-246)||(6258639-6258861)


Alignment Details
Target: chr7 (Bit Score: 195; Significance: 1e-106; HSPs: 1)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 195; E-Value: 1e-106
Query Start/End: Original strand, 24 - 246
Target Start/End: Complemental strand, 6258861 - 6258639
Alignment:
24 aaatattatagaaatcagatgtgtagatataaagaagatttgaaatttgtaatgcacctaaatgccaaatcaccccaacagatgatgtgtcctccgtaga 123  Q
    ||||| |||| |||||| |||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
6258861 aaatagtatataaatcaaatgtatagatataaagaagatttgaaatttgtaatgcacctaaatgccaaatcaccccaacagatgatgtgtcctccgtaga 6258762  T
124 caaatcatcaataacaaactgaaggtctaagcttgtagattcagtgaactttttaaagaactctataatttcctgtaataatcaataaaacaatttttat 223  Q
    ||||||||||||||||||||| ||||||||||||||||| |||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||    
6258761 caaatcatcaataacaaactgtaggtctaagcttgtagactcagtgaactttttgaagaactctataatttcctgtaataatcaataaaacaatttttat 6258662  T
224 aaacttcttctaactaaatacaa 246  Q
    |||||||||||||||||||||||    
6258661 aaacttcttctaactaaatacaa 6258639  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University

This website was viewed 781 times since January 2019
Visitors: 6131