View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0831_low_74 (Length: 256)
Name: NF0831_low_74
Description: NF0831
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0831_low_74 |
 |  |
|
| [»] chr8 (2 HSPs) |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 162; Significance: 1e-86; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 162; E-Value: 1e-86
Query Start/End: Original strand, 50 - 256
Target Start/End: Complemental strand, 27844956 - 27844750
Alignment:
| Q |
50 |
ggtttcaagtaccctttatacctctttaatnnnnnnncttgcttcttattaaaaagaagtatatacattatgtgtcctagtcttacataagattcaagct |
149 |
Q |
| |
|
|||||||||||||| ||||||||||||||| ||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
27844956 |
ggtttcaagtacccgttatacctctttaataaaaaa-cttgcttcttattaaaaagaaatatatacattatgtgtcctagtcttacataagattcaagct |
27844858 |
T |
 |
| Q |
150 |
aaacactatgattattagaggtatatatttctaagacacttaaaaa-gaccccttttttactagaagtttatattttcttttatctcttaaaaattctca |
248 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||| |||||||||| |
|
|
| T |
27844857 |
aaacactatgattattagaggtatatatttctaagacacttaaaaaggaccccttttttactagaagtttatattttcttttatctcttcaaaattctca |
27844758 |
T |
 |
| Q |
249 |
ctttaaaa |
256 |
Q |
| |
|
|||||||| |
|
|
| T |
27844757 |
ctttaaaa |
27844750 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 37; E-Value: 0.000000000006
Query Start/End: Original strand, 10 - 58
Target Start/End: Complemental strand, 27846075 - 27846027
Alignment:
| Q |
10 |
aagaatattagaggtgtatgtatgtattactgttctaatgggtttcaag |
58 |
Q |
| |
|
||||| ||||||||||||||||||||||| |||||||||| |||||||| |
|
|
| T |
27846075 |
aagaaaattagaggtgtatgtatgtattattgttctaatgcgtttcaag |
27846027 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University