View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF0831_low_78 (Length: 252)

Name: NF0831_low_78
Description: NF0831
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF0831_low_78
NF0831_low_78
[»] chr2 (1 HSPs)
chr2 (1-241)||(45097054-45097289)
[»] chr6 (1 HSPs)
chr6 (159-200)||(11775891-11775932)


Alignment Details
Target: chr2 (Bit Score: 209; Significance: 1e-114; HSPs: 1)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 209; E-Value: 1e-114
Query Start/End: Original strand, 1 - 241
Target Start/End: Complemental strand, 45097289 - 45097054
Alignment:
1 gtttaggcccctcgcagtttgtggtggcattttctgaaattgcaattcttagtttttaggtccttttaatttgcctgcaatttagggatctcaaatgttc 100  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||     ||||||||||||||||||||||||||||    
45097289 gtttaggcccctcgcagtttgtggtggcattttctgaaattgcaattcttagtttttaggtcctttt-----gcctgcaatttagggatctcaaatgttc 45097195  T
101 ttaatactgaactcattggtgctacaaatgcagcataaagtgctcatgagaaatatgcttgttttcttggctttcaagtcttctaaggttgtcccttggc 200  Q
    ||||||||||||||||||||||||| ||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||    
45097194 ttaatactgaactcattggtgctacgaatgcagcatagagtgctcatgagaaatatgcttgttttcttggctttcaagtcttctaaggttgtcccgtggc 45097095  T
201 cgttgattgaagaacagatgagagaattgtctctatttcat 241  Q
    |||||||||||||||||||||||||||||||||||||||||    
45097094 cgttgattgaagaacagatgagagaattgtctctatttcat 45097054  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6 (Bit Score: 38; Significance: 0.000000000001; HSPs: 1)
Name: chr6
Description:

Target: chr6; HSP #1
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 159 - 200
Target Start/End: Complemental strand, 11775932 - 11775891
Alignment:
159 ttgttttcttggctttcaagtcttctaaggttgtcccttggc 200  Q
    |||||||||| |||||||||||||||||||||||||||||||    
11775932 ttgttttcttagctttcaagtcttctaaggttgtcccttggc 11775891  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University

This website was viewed 830 times since January 2019
Visitors: 6131