View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0831_low_82 (Length: 251)
Name: NF0831_low_82
Description: NF0831
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0831_low_82 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 84; Significance: 5e-40; HSPs: 2)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 84; E-Value: 5e-40
Query Start/End: Original strand, 1 - 100
Target Start/End: Complemental strand, 26464182 - 26464083
Alignment:
Q |
1 |
cttctccttcaaatcgttcttccgctaattgtgctctcttcgtcatctccgaattcgccaaccgttttccgtttttgtcattccgagtggttcagttcga |
100 |
Q |
|
|
|||||||||||||| ||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||| |||||||| ||||| |
|
|
T |
26464182 |
cttctccttcaaattgttcttccgctaattgtgctctcttcgtcctctccgaattcgccaaccgttttccgtttttgtcattccgcgtggttcaattcga |
26464083 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 37; E-Value: 0.000000000006
Query Start/End: Original strand, 138 - 186
Target Start/End: Complemental strand, 8643147 - 8643099
Alignment:
Q |
138 |
gtgagtgtgagatttcaatctgagtagattctatatattgcacatgaag |
186 |
Q |
|
|
|||||| |||||||||||||||||| |||||||| |||||||||||||| |
|
|
T |
8643147 |
gtgagtttgagatttcaatctgagtggattctatctattgcacatgaag |
8643099 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 76; Significance: 3e-35; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 76; E-Value: 3e-35
Query Start/End: Original strand, 1 - 100
Target Start/End: Complemental strand, 31197918 - 31197819
Alignment:
Q |
1 |
cttctccttcaaatcgttcttccgctaattgtgctctcttcgtcatctccgaattcgccaaccgttttccgtttttgtcattccgagtggttcagttcga |
100 |
Q |
|
|
||||||||||||| ||||||||||||||||||||||||| |||| ||||||||||||||||||||||||| |||||||||||||| |||||||| ||||| |
|
|
T |
31197918 |
cttctccttcaaaccgttcttccgctaattgtgctctctccgtcctctccgaattcgccaaccgttttccatttttgtcattccgcgtggttcaattcga |
31197819 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 44; Significance: 4e-16; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 44; E-Value: 4e-16
Query Start/End: Original strand, 138 - 221
Target Start/End: Original strand, 5874715 - 5874798
Alignment:
Q |
138 |
gtgagtgtgagatttcaatctgagtagattctatatattgcacatgaaggaaaaacttgtgagacgagagtattgtagtgcata |
221 |
Q |
|
|
||||||||||||||||||||||||| |||||||| ||||||| | |||| | || |||| || |||||||||||||||||||| |
|
|
T |
5874715 |
gtgagtgtgagatttcaatctgagtggattctatgtattgcataggaagaagaattttgtcagccgagagtattgtagtgcata |
5874798 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 37; Significance: 0.000000000006; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 37; E-Value: 0.000000000006
Query Start/End: Original strand, 138 - 186
Target Start/End: Original strand, 3245533 - 3245581
Alignment:
Q |
138 |
gtgagtgtgagatttcaatctgagtagattctatatattgcacatgaag |
186 |
Q |
|
|
|||||| |||||||||||||||||| |||||||| |||||||||||||| |
|
|
T |
3245533 |
gtgagtttgagatttcaatctgagtggattctatctattgcacatgaag |
3245581 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 138 - 186
Target Start/End: Original strand, 29458981 - 29459029
Alignment:
Q |
138 |
gtgagtgtgagatttcaatctgagtagattctatatattgcacatgaag |
186 |
Q |
|
|
|||||| ||||||||||||| |||| |||| ||| |||||||||||||| |
|
|
T |
29458981 |
gtgagtatgagatttcaatcagagtggattatatctattgcacatgaag |
29459029 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 34; Significance: 0.0000000003; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 8 - 61
Target Start/End: Complemental strand, 37912464 - 37912411
Alignment:
Q |
8 |
ttcaaatcgttcttccgctaattgtgctctcttcgtcatctccgaattcgccaa |
61 |
Q |
|
|
|||| |||||||||| ||||||||||||||||| ||| | |||||||||||||| |
|
|
T |
37912464 |
ttcagatcgttcttctgctaattgtgctctctttgtcctttccgaattcgccaa |
37912411 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 1543 times since January 2019
Visitors: 6145