View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0831_low_85 (Length: 242)
Name: NF0831_low_85
Description: NF0831
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0831_low_85 |
 | |
|
| [»] chr4 (1 HSPs) |
| |
|
Alignment Details
Target: chr4 (Bit Score: 156; Significance: 5e-83; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 156; E-Value: 5e-83
Query Start/End: Original strand, 22 - 242
Target Start/End: Complemental strand, 38077124 - 38076903
Alignment:
| Q |
22 |
tctctctccatttatgtgtctcctatctgtgtatgtttgtcaacaactcaaaaggtacannnnnnn-ggacaaaaactcaaaacttatctatcatgtagt |
120 |
Q |
| |
|
|||||||||||||||||||||| | |||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
38077124 |
tctctctccatttatgtgtctcatgtctgtgtatgtttgtcaacaactcaaaaggtacattttttttggacaaaaactcaaaacttatctatcatgtagt |
38077025 |
T |
|
| Q |
121 |
tattttttggttagatannnnnnnaaccaagttcaccttaagaaaaccatttaatttattatgtttaaatttaaactcaaatccacgacataattatagg |
220 |
Q |
| |
|
||||||||||||||||| ||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
38077024 |
tattttttggttagatatttttttaaccaagttcaccttaagaaaaccatttaatttattacgtttaaatttaaactcaaatcgacgacataattatagg |
38076925 |
T |
|
| Q |
221 |
gtatttgaaaagtaattaccta |
242 |
Q |
| |
|
|||||||||||||||||||||| |
|
|
| T |
38076924 |
gtatttgaaaagtaattaccta |
38076903 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 1135 times since January 2019
Visitors: 6137