View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0831_low_86 (Length: 241)
Name: NF0831_low_86
Description: NF0831
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0831_low_86 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 150; Significance: 2e-79; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 150; E-Value: 2e-79
Query Start/End: Original strand, 69 - 226
Target Start/End: Complemental strand, 13854363 - 13854206
Alignment:
Q |
69 |
atgtcttcaatatgaattgcaagtgctacatagattatcactgattgaagttgattgtaacttagtataatacattatcatacagtgatgcacttttctc |
168 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||| |
|
|
T |
13854363 |
atgtcttcaatatgaattgcaagtgctacatagattatcactgattgaagttgattgtaacttagtataatacattatcatacaatgatgcacttttctc |
13854264 |
T |
 |
Q |
169 |
tcaaaactccaattcaaataaatgcttttaactagattattttgtcaatgcttaaagt |
226 |
Q |
|
|
|||||||||| ||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
13854263 |
tcaaaactccgattcaaataaatgcttttaactagattattttgtcaatgcttaaagt |
13854206 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University