View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0831_low_91 (Length: 219)
Name: NF0831_low_91
Description: NF0831
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0831_low_91 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 117; Significance: 9e-60; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 117; E-Value: 9e-60
Query Start/End: Original strand, 64 - 201
Target Start/End: Original strand, 41668085 - 41668222
Alignment:
Q |
64 |
cgaaattatttgattccaggatcacagnnnnnnncattttttccatttatgatacacacggctacatgaattgttcaactactacgacttttctgttatg |
163 |
Q |
|
|
||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
41668085 |
cgaaattatttgattccaggatcacagaaaaaaacattttttccatttatgatacacacggctacatgaattgttcaactactacgacttttctgttatg |
41668184 |
T |
 |
Q |
164 |
agtagtaaccttcaacccaaatcttgcccaacattgtg |
201 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||| |
|
|
T |
41668185 |
agtagtaaccttcaacccaaatcttgcccaacattgtg |
41668222 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 1341 times since January 2019
Visitors: 6140