View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0832_low_3 (Length: 334)
Name: NF0832_low_3
Description: NF0832
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0832_low_3 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 189; Significance: 1e-102; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 189; E-Value: 1e-102
Query Start/End: Original strand, 76 - 284
Target Start/End: Complemental strand, 3340914 - 3340707
Alignment:
Q |
76 |
gaccataccaaaattcccttgagatcaatatgtagggaagggtctttattcctatcaaggataacttcagccaattgtggtacaaaatgtcctgaaaatc |
175 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
3340914 |
gaccataccaaaattcccttgagatcaatatgtagggaagggtctttattcctatcaaggataacttcagccaattgtggtacaaaatgtcctgaaaatc |
3340815 |
T |
 |
Q |
176 |
atgcttcatgatcaattcaaaggacttaaaaattacattttaggtgattattctgattgtgatttcaatacctccatagctctctcctcctatgtacaat |
275 |
Q |
|
|
||||||||||||||||||||||||||| |||||||||| |||| ||||||||||||| |||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
3340814 |
atgcttcatgatcaattcaaaggactt-aaaattacatgttagatgattattctgatggtgatttcaatacctccatagctctctcctcctatgtacaat |
3340716 |
T |
 |
Q |
276 |
gcccttgtt |
284 |
Q |
|
|
||||||||| |
|
|
T |
3340715 |
gcccttgtt |
3340707 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 79 - 146
Target Start/End: Complemental strand, 3333335 - 3333268
Alignment:
Q |
79 |
cataccaaaattcccttgagatcaatatgtagggaagggtctttattcctatcaaggataacttcagc |
146 |
Q |
|
|
||||||||||| ||||||||||||||||| ||||||||||| || || ||||||| ||| | |||||| |
|
|
T |
3333335 |
cataccaaaatgcccttgagatcaatatgaagggaagggtcattgtttctatcaatgatgagttcagc |
3333268 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 43; Significance: 0.000000000000002; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 79 - 201
Target Start/End: Complemental strand, 8349044 - 8348922
Alignment:
Q |
79 |
cataccaaaattcccttgagatcaatatgtagggaagggtctttattcctatcaaggataacttcagccaattgtggtacaaaatgtcctgaaaatcatg |
178 |
Q |
|
|
||||||||||| ||||||||||||||||| |||||||||| || || ||||||| ||||| |||||| | | ||||||| | | ||||| ||| |||| |
|
|
T |
8349044 |
cataccaaaatgcccttgagatcaatatgaagggaagggttattgtttctatcaatgataagttcagcaagctctggtacatactttcctgcaaaacatg |
8348945 |
T |
 |
Q |
179 |
cttcatgatcaattcaaaggact |
201 |
Q |
|
|
|| |||||||||||| |||||| |
|
|
T |
8348944 |
ttttatgatcaattcagaggact |
8348922 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 79 - 199
Target Start/End: Original strand, 42820577 - 42820697
Alignment:
Q |
79 |
cataccaaaattcccttgagatcaatatgtagggaagggtctttattcctatcaaggataacttcagccaattgtggtacaaaatgtcctgaaaatcatg |
178 |
Q |
|
|
||||||||||| ||||||||||||||||| |||||||||| || || ||||||| ||||| |||||| | | ||||||| | | ||||| ||| |||| |
|
|
T |
42820577 |
cataccaaaatgcccttgagatcaatatgaagggaagggttattgtttctatcaatgataagttcagcaagctctggtacatactttcctgcaaaacatg |
42820676 |
T |
 |
Q |
179 |
cttcatgatcaattcaaagga |
199 |
Q |
|
|
|| |||||||||||| |||| |
|
|
T |
42820677 |
ttttatgatcaattcagagga |
42820697 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 37; Significance: 0.000000000008; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 37; E-Value: 0.000000000008
Query Start/End: Original strand, 78 - 174
Target Start/End: Original strand, 35794259 - 35794355
Alignment:
Q |
78 |
ccataccaaaattcccttgagatcaatatgtagggaagggtctttattcctatcaaggataacttcagccaattgtggtacaaaatgtcctgaaaat |
174 |
Q |
|
|
||||||||||||||||||||||||||| | || || ||||| || ||||||||| |||||| |||||| | || ||||||| | | |||||||||| |
|
|
T |
35794259 |
ccataccaaaattcccttgagatcaatgtaaagagatgggtccttgttcctatcatggataagttcagcaagttctggtacatactttcctgaaaat |
35794355 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University