View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0832_low_5 (Length: 288)
Name: NF0832_low_5
Description: NF0832
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0832_low_5 |
 |  |
|
| [»] chr5 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 178; Significance: 5e-96; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 178; E-Value: 5e-96
Query Start/End: Original strand, 95 - 288
Target Start/End: Original strand, 22364635 - 22364828
Alignment:
| Q |
95 |
catcatcataaacataaactcttacacaatgaaatgtatagacccaatacacaatgttggcaacaaatttaatgcatagactccaaataataatttaatt |
194 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
22364635 |
catcatcataaacataaactcttacacaatgaaatgtatagacccaatacacaatgttggcaacaaatttaatgaatagactccaaataataatttaatt |
22364734 |
T |
 |
| Q |
195 |
tcaaacaattgtgagcaaaagattaacaatttgtcatatatatttttcactataaatatatttagaaagaattcagaataaaatattgcacaaa |
288 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||| |||||||||| |||||||||||||||||| |
|
|
| T |
22364735 |
tcaaacaattgtgagcaaaagattaacaatttgtcatatatatttgtcactataaatatatttaaaaagaattcaaaataaaatattgcacaaa |
22364828 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University