View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0833_high_17 (Length: 228)
Name: NF0833_high_17
Description: NF0833
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0833_high_17 |
 |  |
|
[»] chr5 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 153; Significance: 3e-81; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 153; E-Value: 3e-81
Query Start/End: Original strand, 11 - 228
Target Start/End: Original strand, 22578234 - 22578441
Alignment:
Q |
11 |
gcatgtatccaaaccaatgcaaaagctatgaggttgagttgaggtttctttcaagcaaaggatttgcttttaattaactctgactatatatatctattat |
110 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||| |||||||| |
|
|
T |
22578234 |
gcatgtatccaaaccaatgcaaaagctatgaggttgag-----gtttctttcaagcaaaggatttgcttttaattaactctgactata----tctattat |
22578324 |
T |
 |
Q |
111 |
ctactctacacaccatccattatcctaatatttttagtttggaaaatgttaatcaatgttcgtggaaacaaataggataaaactattttgaaaaatgttt |
210 |
Q |
|
|
||||||||| ||||||||||||||||||||||||||||||||||||||||||| ||||| |||| ||||||||||||||||||||| ||||||||| ||| |
|
|
T |
22578325 |
ctactctactcaccatccattatcctaatatttttagtttggaaaatgttaattaatgtccgtgaaaacaaataggataaaactatcttgaaaaat-ttt |
22578423 |
T |
 |
Q |
211 |
aacatagagaataattga |
228 |
Q |
|
|
|||||||||||||||||| |
|
|
T |
22578424 |
aacatagagaataattga |
22578441 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 2353 times since January 2019
Visitors: 6162