View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0833_high_2 (Length: 478)
Name: NF0833_high_2
Description: NF0833
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0833_high_2 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 263; Significance: 1e-146; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 263; E-Value: 1e-146
Query Start/End: Original strand, 105 - 468
Target Start/End: Original strand, 3985625 - 3985998
Alignment:
Q |
105 |
gaagagatgtttttatggtgtttattggagctcaagggtgggaagagaatgtgagatgttattataggggttttggtcggttcttatggtttttt-gaag |
203 |
Q |
|
|
||||||| |||||||||||||||||||||||||||||||||||||||||||| |||||||||| ||||||||||||||||||||||||||||||| |||| |
|
|
T |
3985625 |
gaagagacgtttttatggtgtttattggagctcaagggtgggaagagaatgtaagatgttattttaggggttttggtcggttcttatggtttttttgaag |
3985724 |
T |
 |
Q |
204 |
gattttttgtacgatt-----------ggtgtttgaaacttgtgtttgcagtcatccatgatgaagtttgaggttctgtctttacttttgatttatgcag |
292 |
Q |
|
|
| ||||| |||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
3985725 |
ggtttttggtacgattagcggacgattggtgtttgaaacttgtgtttgcagtcatccatgatgaagtttgaggttctgtctttacttttgatttatgcag |
3985824 |
T |
 |
Q |
293 |
ttgtgtaaggatttggttttgactttggtggttagtttctattgatttttatggtagcaattagtttggtggtgtttttattggagttttgatgtgcgga |
392 |
Q |
|
|
|| ||| |||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
3985825 |
ttatgtggggatttggtt--gactttggtggttagtttctattgatttttatggtagcaattagtttggtggtgtttttattggagttttgatgtgcgga |
3985922 |
T |
 |
Q |
393 |
gtataaggttttcttttgggtgttatgtctatataatgtgtcttttgttatgtcgtttatgtattatcggtctctg |
468 |
Q |
|
|
||||||||||||||||| |||||||||||||||||||||| |||||||||| || ||||||| |||||||| |||| |
|
|
T |
3985923 |
gtataaggttttcttttaggtgttatgtctatataatgtgccttttgttatatcatttatgtcttatcggtttctg |
3985998 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 41; E-Value: 0.00000000000005
Query Start/End: Original strand, 28 - 68
Target Start/End: Original strand, 3985551 - 3985591
Alignment:
Q |
28 |
cagaccgggggtcaatcggtggtggaatctgaatgagtgtg |
68 |
Q |
|
|
||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
3985551 |
cagaccgggggtcaatcggtggtggaatctgaatgagtgtg |
3985591 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University