View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF0833_high_20 (Length: 218)

Name: NF0833_high_20
Description: NF0833
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF0833_high_20
NF0833_high_20
[»] chr1 (1 HSPs)
chr1 (11-143)||(30501810-30501942)


Alignment Details
Target: chr1 (Bit Score: 133; Significance: 3e-69; HSPs: 1)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 133; E-Value: 3e-69
Query Start/End: Original strand, 11 - 143
Target Start/End: Original strand, 30501810 - 30501942
Alignment:
11 cactagtaggtagagtgagatttgaaatgtctctaatatggatggcataacctaactgaattgaaaacgataattaatgttataactattacttgaaagt 110  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
30501810 cactagtaggtagagtgagatttgaaatgtctctaatatggatggcataacctaactgaattgaaaacgataattaatgttataactattacttgaaagt 30501909  T
111 cttggtaaaccaaggagatgaattacctatgat 143  Q
    |||||||||||||||||||||||||||||||||    
30501910 cttggtaaaccaaggagatgaattacctatgat 30501942  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University

This website was viewed 3173 times since January 2019
Visitors: 6172