View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0833_high_20 (Length: 218)
Name: NF0833_high_20
Description: NF0833
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0833_high_20 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 133; Significance: 3e-69; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 133; E-Value: 3e-69
Query Start/End: Original strand, 11 - 143
Target Start/End: Original strand, 30501810 - 30501942
Alignment:
| Q |
11 |
cactagtaggtagagtgagatttgaaatgtctctaatatggatggcataacctaactgaattgaaaacgataattaatgttataactattacttgaaagt |
110 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30501810 |
cactagtaggtagagtgagatttgaaatgtctctaatatggatggcataacctaactgaattgaaaacgataattaatgttataactattacttgaaagt |
30501909 |
T |
 |
| Q |
111 |
cttggtaaaccaaggagatgaattacctatgat |
143 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |
|
|
| T |
30501910 |
cttggtaaaccaaggagatgaattacctatgat |
30501942 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University